Performance of the ACMG-AMP criteria in a large familial renal glucosuria cohort with identified SLC5A2 sequence variants.

Familial Renal Glucosuria (FRG) is a co-dominantly inherited trait characterized by orthoglycaemic glucosuria. From 2003 to 2015 we have reported several cohorts validating SLC5A2 (16p11.2), encoding SGLT2 (Na+/glucose cotransporter family member 2), as the gene responsible for FRG. The aim of this work was to validate the variants identified in our extended FRG cohort of published, as well more recent unreported cases, according to the ACMG-AMP 2015 criteria. Forty-six variants were evaluated, including 16 novel alleles first described in this study. All are rare, ultra-rare or absent from population databases and most are missense changes. According to the ACMG-AMP standards, only 74% of the variants were classified as P/LP. The lack of descriptions of unrelated patients with similar variants or failing to test additional affected family members, averted a conclusion for pathogenicity in the alleles that scored VUS, highlighting the importance of both family testing and variant reporting. Finally, the cryo-EM structure of the hSGLT2-MAP17 complex in the empagliflozin-bound state improved the ACMG-AMP pathogenicity score by identifying critical/functional protein domains.

Hereditary renal glycosuria, diabetes and responses to SGLT2 inhibitor.

AIMS: To present the clinical features of two rare cases with hereditary renal glycosuria and diabetes, explore their responses to sodium-glucose cotransporter 2 (SGLT2) inhibitor, and summarize the reported solute carrier family 5 member 2 (SLC5A2) mutations and related phenotypes. METHODS: Two patients were followed up for 6.5 and 3 years respectively. SLC5A2 and hepatocyte nuclear factor 1-alpha (HNF1A) gene were sequenced. We used the flash glucose monitoring system to evaluate the efficacy of SGLT2 inhibitor treatment. Then we retrieved all the literature and analyzed SLC5A2 gene mutations and the phenotypes. RESULTS: During long-time follow up, the two patients had frequent unproportional renal glycosuria in the morning even when their fasting serum glucose was only slightly increased. A novel rare mutation V359G and a pathogenic rare mutation ivs7 + 5G > A in SLC5A2 gene were found respectively. In Case 1, the 24 h glucose excretion was 2.2 g/d and increased to 103 g/d after dapaglifozin treatment, whereas the average glucose (6.33 ± 1.56 vs. 6.28 ± 1.74 mmol/L), and time in range (TIR) (95% vs. 93%) were similar. In Case 2, the 24 h glycosuria was 121.4 g/d and increased to 185.8 g/day after dapaglifozin add-on therapy, with a further reduction of average glucose (9.11 ± 2.63 vs. 7.54 ± 2.39 mmol/L, p < 0.001) and better TIR (70% vs. 84%). We reviewed 139 cases with hereditary renal glycosuria and SLC5A2 gene mutation. The urine glucose was highest in patients with homozygous mutations [64.0(36.6-89.6)g/24 h] compared with compound heterozygous mutations [25.9(14.4-41.2)g/24 h] and heterozygous mutations [3.45(1.41-7.50)g/24 h] (p < 0.001). CONCLUSIONS: Genetic renal glycosuria could not protect individuals completely from developing diabetes. Patients with SGLT2 gene mutations are still responsive to the SGLT2 inhibitor treatment.

Clinical features of pediatric renal glucosuria cases due to SLC5A2 gene variants.

BACKGROUND: Familial renal glycosuria (FRG) is a rare renal tubular disorder characterized by a variable loss of glucose in the urine despite normal blood glucose levels, which is seen in a condition in which other tubular functions are preserved. In this study, the molecular and clinical characteristics of pediatric FRG cases due to SLC5A2 gene variants were defined. METHODS: Demographic features, diagnostic tests, and molecular analyses of patients with a diagnosis of FRG cases due to SLC5A2 gene variants were retrospectively analyzed between 2016 and 2019. RESULTS: The data of 16 patients who were clinically and genetically diagnosed with FRG in a 4-year period were analyzed. Seven (44%) of the cases were female and 9 (56%) were male. The median age at diagnosis was 6 years old (2 months old to 17 years old). Neuromotor development was found to be appropriate for the age in each case. Systemic blood pressure was evaluated as normal. A homozygous pathogenic variant in the SLC5A2 gene was detected in 14 patients in the genetic examination. A heterozygous variant was detected in one patient. In the other patient, two different heterozygous pathological variants were found in the SLC5A2 gene. CONCLUSIONS: It was revealed that growth and development were normal in children with glucosuria due to variations in the SCL5A2 gene. Renal function tests and urinary amino acid excretion were also within normal values. In our case series, the most common genetic variation in the SCL5A2 gene was the A219T (c.655G>A) variant.

Persistently high urine glucose levels caused by familial renal glycosuria.

Glycosuria generally occurs when the threshold for glucose reabsorption by the proximal renal tubule is exceeded or when reabsorption of filtered glucose is impaired. Although the discovery of glycosuria in a child will prompt screening for diabetes mellitus, it is also a sign of a rare tubulopathy called "familial renal glycosuria" (OMIM #233100). This tubulopathy is linked to a defect in the sodium-glucose co-transporter 2, encoded by the SLC5A2 gene. Here, we describe and discuss two pediatric cases in whom familial renal glycosuria was discovered fortuitously after the observation of persistently high urine glucose levels in the absence of hyperglycemia.

SLC5A2 mutations, including two novel mutations, responsible for renal glucosuria in Chinese families.

BACKGROUND: Familial renal glucosuria (FRG) is characterized by persistent glucosuria without other impairments of tubular function in the presence of normal serum glucose. SGLT2, which is almost exclusively expressed in the kidney, accounts for most of the glucose reabsorption. Recently, some studies have confirmed that SLC5A2 mutations are responsible for the pathogenesis of familial renal glucosuria, but FRG cases are still rare. Furthermore, there are a few reports about splice-site mutations in previous studies, but the effect of these variants at the mRNA level has hardly been verified. METHODS: Ten patients were recruited in our renal division because of persistent glucosuria, and clinical data of the patients and their family members were recorded as much as possible. The entire coding region and adjacent intronic segments of SLC5A2 were sequenced in FRG patients and their relatives. Permanent growing lymphoblastoid cell lines from FRG patients were established to better preserve genetic information. RESULTS: A total of nine different mutations were identified: IVS1-16C > A, c.305C > T/p.(A102V), c.395G > A/p.(R132H), c.736C > T/p.(P246S), c.886(-10_-31)delGCAAGCGGGCAGCTGAACGCCC, c.1152_1163delGGTCATGCTGGC/p.(Val385_Ala388del), c.1222G > T/p.(D408Y), c.1496G > A/p.(R499H) and c.1540C > T/p.(P514S); two novel mutations in SLC5A2, c.1222G > T/p.(D408Y) and c.1496G > A/p.(R499H), were identified in the Chinese FRG pedigrees. Ten individuals with heterozygous or compound heterozygous variants had glucosuria in the range of 3.1 to 37.6 g/d. CONCLUSION: We screened ten additional Chinese FRG pedigrees for mutations in the SLC5A2 gene and found nine mutations, including two novel mutations. Most variants were private, but IVS1-16C > A and c.886(-10_-31) del may be high frequency splice-site mutations that could be preferentially screened when variants cannot be found in the SLC5A2 exon. Furthermore, we successfully established a permanent growing lymphoblastoid cell line from patients with FRG, which could facilitate further studies of the SLC5A2 gene. The current study provides a valuable clue for further research on the molecular mechanism of SGLT2.

Clinical and genetic analysis in a family with familial renal glucosuria: Identification of an N101K mutation in the sodium-glucose cotransporter 2 encoded by a solute carrier family 5 member 2 gene.

We report the identification of a mutation in the solute carrier family 5 member 2 (SLC5A2) gene, which encodes sodium-glucose cotransporter 2, in a family with familial renal glucosuria. The proband was a 26-year-old Japanese man referred to the diabetes division with repeated glucosuria without hyperglycemia. His mother, uncle and grandfather also had a history of glucosuria. A heterozygous missense mutation (c.303T>A:p.N101K) in SLC5A2 was identified in the patient and his mother, but not in 200 chromosomes from 100 healthy and unrelated individuals, or in 3,408 Japanese individuals in the Tohoku Medical Megabank. Furthermore, bioinformatics software predicted that this lesion would be pathogenic. We infer that the mutation led to clinically relevant sodium-glucose cotransporter 2 dysfunction. The patient showed no symptoms of hypoglycemia, but continuous glucose monitoring confirmed asymptomatic hypoglycemia.

Renal glucosuria is associated with lower body weight and lower rates of elevated systolic blood pressure: results of a nationwide cross-sectional study of 2.5 million adolescents.

BACKGROUND: Gene coding mutations found in sodium glucose co-transporters (SGLTs) are known to cause renal glucosuria. SGLT2 inhibitors have recently been shown to be effective hypoglycemic agents as well as possessing cardiovascular and renal protective properties. These beneficial effects have to some extent, been attributed to weight loss and reduced blood pressure. The aim of the current study was to evaluate the prevalence of renal glucosuria amongst a large cohort of Israeli adolescents and to investigate whether renal glucosuria is associated with lower body weight and lower blood pressure values. METHODS: Medical and socio-demographic data were collected from the Israeli Defense Force's conscription center's database. A cross-sectional study to evaluate the association between conscripts diagnosed as overweight [BMI percentiles of ≥ 85 and < 95 and obesity (≥ 95 BMI percentile)] and afflicted with renal glucosuria was conducted. In addition, we assessed the association of renal glucosuria with elevated diastolic and systolic blood pressure. Multinomial regression models were used. RESULTS: The final study cohort comprised 2,506,830 conscripts of whom 1108 (0.044%) were diagnosed with renal glucosuria, unrelated to diabetes mellitus, with males twice as affected compared to females. The adjusted odds ratio for overweight and obesity was 0.66 (95% CI 0.50-0.87) and 0.62 (95% CI 0.43-0.88), respectively. Adolescents afflicted with renal glucosuria were also less likely to have an elevated systolic blood pressure of 130-139 mmHg with an adjusted odds ratio of 0.74 (95% CI 0.60-0.90). CONCLUSIONS: Renal glucosuria is associated with lower body weight and obesity as well as with lower rates of elevated systolic blood pressure.

Sodium-Glucose Cotransporter-2 Inhibitors: Lack of a Complete History Delays Diagnosis.

On 15 May 2015, the U.S. Food and Drug Administration (FDA) warned that administration of sodium-glucose cotransporter-2 (SGLT2) inhibitors could lead to ketoacidosis in patients with diabetes mellitus. This announcement came more than 2 years after the FDA's first approval of an SGLT2 inhibitor, although the phenomenon had been known for more than 125 years. Luminaries of diabetes research (including Josef von Mering, Frederick Allen, I. Arthur Mirsky, and George Cahill) had described ketosis and ketoacidosis induced by administration of the phytochemical phlorizin, the prototypical SGLT inhibitor, as well as in patients with familial renal glucosuria, a condition that is considered a natural model of SGLT2 inhibition. Neither government regulators nor manufacturers of SGLT2 inhibitors evinced an awareness of this extensive historical record. The absence of historical inquiry delayed notice of ketoacidosis as an adverse reaction, which could have reduced the burden of illness from these drugs.

Glucogenosis Hepática. Características clínicas, laboratoriales e imagenológicas en pacientes pediátricos menores de 15 años / Hepatic glycogenosis. Clinical, laboratory and imaging characteristics in pediatric patients under 15 years old

Antecedentes: La glucogenosis (GSD) hepática es una enfermedad hereditaria autosómica recesiva caracterizada por la alteración del depósito de glucógeno en los tejidos. La enfermedad se presenta con hepatomegalia, debilidad muscular y retraso del crecimiento. Esta patología usualmente se diagnostica clínicamente a partir de los 6 meses de edad cuando la ingesta de alimentos del lactante es más espaciada y puede debutar con sintomatología de hipoglicemia. Debido a la inespecificidad de la presentación clínica de la enfermedad es muy importante la sospecha diagnóstica desde los centros de primer nivel de atención y su derivación oportuna a centros de especialidad. Objetivo: Evaluar y describir el perfil nutricional y clínico en pacientes menores de 15 años con Glucogenosis Hepática. Método: Se describe una serie de casos de 14 pacientes menores de 15 años con diagnóstico clínico de GSD hepática, atendidos en la consulta de Gastroenterología y Nutrición Pediátrica del Hospital Carlos Andrade Marín entre 2016 y 2018. El diagnóstico se lo realizó de acuerdo a la clínica que presentó cada paciente como la presencia de distensión abdominal, hepatomegalia, adinamia, retraso en el crecimiento y datos laboratoriales como niveles de glicemia en sangre periférica, transaminasas, y realización de elastografía entre los principales. Se analizaron datos sociodemográficos, antropométricos, de laboratorio (transaminasas, glicemia periférica) y elastografía hepática. Para el análisis de datos se creó una base de datos en Microsoft Excel 2013 y se procesó con el programa Epi Info 7. Resultados: En este grupo de casos, los tipos específicos de GSD hepática fueron tipo IX, 57,14% (8), tipo III, 28,57% (4) y tipo Ia-b, 14,29% (2) pacientes. La prevalencia de características clínicas ante la sospecha de la GSD hepática fueron: hepatomegalia 100% (14), y retraso en el crecimiento el 64,3% (9). De acuerdo a los exámenes de sangre periférica los valores promedio de transaminasas hepáticas (AST/TGO U/L) (ALT/TGP U/L) y glucosa, fueron de 364±384, 302±255 y 61±15 mg/dL, respectivamente. La elastografía con la que se evaluó el nivel de fibrosis hepática al momento del diagnóstico arrojó los siguientes resultados: F0 (no fibrosis hepática) en el 28,57% (4), F1 con el 28,57% (4), F2-F3 con el 35,71% (5), y F4 7,14%. Conclusión: La Glucogenosis es una patología que debería ser sospechada a tiempo en centros del primer nivel de salud para luego referir oportunamente los casos a los centros de referencia. La hepatomegalia y el retardo en el crecimiento son signos cardinales de alerta para la sospecha de esta patología.

A novel compound heterozygous mutation in SLC5A2 contributes to familial renal glucosuria in a Chinese family, and a review of the relevant literature.

Familial renal glucosuria (FRG) is a rare condition that involves isolated glucosuria despite normal blood glucose levels. Mutations in the solute carrier family 5 member 2 (SLC5A2) gene, which encodes sodium­glucose cotransporter 2 (SGLT2), have been reported to be responsible for the disease. Genetic testing of the SLC5A2 gene was conducted in a Chinese family with FRG. A number of online tools were used to predict the potential effect of the identified mutations on SGLT2 function. Additionally, the SLC5A2 mutations previously reported in PubMed were summarized. A novel compound heterozygous mutation (c.514T>C, p.W172R; c.1540C>T, p.P514S) of the SLC5A2 gene in a Chinese child with FRG was identified. In total, 86 mutations of the SLC5A2 gene have been reported to be associated with FRG. The novel compound heterozygous mutation (c.514T>C, p.W172R; c.1540C>T, p.P514S) of the SLC5A2 gene may be responsible for the onset of FRG. The present study provides a starting point for further investigation of the molecular pathogenesis of the SLC5A2 gene mutation in patients with FRG.

Identification of ten novel SLC5A2 mutations and determination of the renal threshold for glucose excretion in Chinese patients with familial renal glucosuria.

BACKGROUND: Familial renal glucosuria (FRG) is a rare renal tubular disorder characterized by isolated persistent glucosuria without both abnormal glucose metabolism and any signs of proximal tubular dysfunction. SLC5A2 gene mutations are responsible for most FRG cases. METHODS: Quantitative test for 24-hour urine glucose and RTG were determined in 9 families (totaling 25 subjects). All coding regions, including intron-exon boundaries, were analyzed with PCR followed by direct sequence analysis. RESULTS: Ten novel mutations were identified (c.331 T > C, p.W111R; c.374T>C, p.M125T; c.394C>T, p.R132C; c.612G>C, p.Q204H; c.829C>T, p.P277S; c.880G>A, p.D294N; c.1129G>A, p.G377S; c.1194C>A, p.F398L; c.1540C > T, p.P514S and c.1573C>T, p.H525Y). c.886(-10_-31)del that is specific to Chinese population was found in 5 out of 9 families, with a mutation rate of 28% (5/18). The compound heterozygotes presented with much lower RTG values (1.28 ±â€¯0.10 mmol/L), compared with the carriers of heterozygous variants (5.14 ±â€¯0.77 mmol/L) (p<0.01); c.886(-10_-31)del heterozygotes had significant lower RTG values than others (4.43 ±â€¯0.37 vs 5.7 ±â€¯0.51 mmol/L; p<0.01). CONCLUSIONS: Ten novel SLC5A2 mutations are found and c.886(-10-31)del may be a hot spot mutation in Chinese population. Compound heterozygotes had much lower RTG values than simple heterozygotes. Mixed-meal tolerance test is a simple method for determining RTG in FRG patients.

Acquired renal glucosuria in an undifferentiated connective tissue disease patient with a SLC5A2 heterozygous mutation: A case report.

INTRODUCTION: Renal glucosuria is a renal tubular disorder caused by genetic conditions, drugs, and poisons. Mutations in the SLC5A2 gene are recently found to be responsible for the inherited renal glucosuria, while undifferentiated connective tissue disease (UCTD) was not considered pathogenic for renal glucosuria. Here, we present a case of acquired renal glucosuria in a UCTD patient. PATIENT CONCERNS: A 30-year-old woman was seen in the outpatient clinic for complaints of frequent urination and dysuria. Laboratory tests showed a urinary tract infection (UTI) and persistent renal glucosuria. After antibiotic treatment, the UTI symptoms were relieved, but the renal glucosuria remained. DIAGNOSIS: Laboratory tests ruled out renal tubular acidosis and diabetes mellitus. Genetic analysis showed a heterozygous mutations in the SLC5A2 gene. Meanwhile, immunological tests showed a high antinuclear antibody titer (1:160) and an elevated anti-Rho/SSA antibody level. Schirmer test, tear breakup time, and lip biopsy results were all negative. The patient did not meet the criteria for any known connective diseases. Therefore, she was diagnosed with UCTD. INTERVENTIONS: The patient was started with the treatment of Hydroxychloroquine. OUTCOMES: Hydroxychloroquine treatment resolved the renal glucosuria. The patient's follow- up urinalysis showed no glucosuria at all. LESSONS: This is the first case report to demonstrate that UCTD may induce renal glucosuria in a patient with a heterozygous mutation in SLC5A2. This case suggests that during the process of diagnosing renal glucosuria, in addition to familial renal glucosuria (FRG), autoimmune diseases, though rare, should also be taken into consideration.

Increased Muscle Mass Protects Against Hypertension and Renal Injury in Obesity.

Background Obesity compromises cardiometabolic function and is associated with hypertension and chronic kidney disease. Exercise ameliorates these conditions, even without weight loss. Although the mechanisms of exercise's benefits remain unclear, augmented lean body mass is a suspected mechanism. Myostatin is a potent negative regulator of skeletal muscle mass that is upregulated in obesity and downregulated with exercise. The current study tested the hypothesis that deletion of myostatin would increase muscle mass and reduce blood pressure and kidney injury in obesity. Methods and Results Myostatin knockout mice were crossed to db/db mice, and metabolic and cardiovascular functions were examined. Deletion of myostatin increased skeletal muscle mass by ≈50% to 60% without concomitant weight loss or reduction in fat mass. Increased blood pressure in obesity was prevented by the deletion of myostatin, but did not confer additional benefit against salt loading. Kidney injury was evident because of increased albuminuria, which was abolished in obese mice lacking myostatin. Glycosuria, total urine volume, and whole kidney NOX-4 levels were increased in obesity and prevented by myostatin deletion, arguing that increased muscle mass provides a multipronged defense against renal dysfunction in obese mice. Conclusions These experimental observations suggest that loss of muscle mass is a novel risk factor in obesity-derived cardiovascular dysfunction. Interventions that increase muscle mass, either through exercise or pharmacologically, may help limit cardiovascular disease in obese individuals.

Renal glucosuria in schoolchildren: Clinical characteristics.

BACKGROUND: We conducted an annual urine glucose screening program at schools, and diagnosed schoolchildren with diabetes at an early stage of the disease. We also identified some cases of renal glucosuria (RG), based on positive urine glucose with normal glucose tolerance. METHODS: During 2000-2015, 3 309 631 schoolchildren participated in the screening program. The positive rate for glucosuria in the first test was approximately 0.1%, whereas on repeat urine test it was approximately 0.05%. In total 350 schoolchildren were positive for glucosuria on detailed examination. Oral glucose tolerance test (OGTT) was also used to evaluate glucose intolerance. RESULTS: One hundred and two schoolchildren (29.7%) were diagnosed with diabetes, whereas RG was identified in 246 (70.3%) with normal glucose metabolism. In regard to the characteristics of RG, the percentage of boys was 50.3%, and the mean age at diagnosis was 11.2 ± 2.4 years. Twenty-eight children (11.4%) were overweight (body mass index standard deviation score [BMI-SDS] > +2.0 SD), whereas five (2.0%) were underweight (BMI-SDS < -2.0 SD). First-degree family history was suspected in 176 cases (71.5%). All RG subjects had normal glucose tolerance in the absence of insulin resistance and decreased insulin secretion (homeostasis model assessment for ß-cell function, 78.8 ± 59.5%) on OGTT. CONCLUSIONS: RG is not rare in Japanese schoolchildren with glucosuria. This disorder seems to have a strong genetic background, and to involve less growth retardation and weight loss than expected despite continuous excretion of glucose in urine.

8-Aminoguanine Induces Diuresis, Natriuresis, and Glucosuria by Inhibiting Purine Nucleoside Phosphorylase and Reduces Potassium Excretion by Inhibiting Rac1.

Background 8-Aminoguanosine and 8-aminoguanine are K+-sparing natriuretics that increase glucose excretion. Most effects of 8-aminoguanosine are due to its metabolism to 8-aminoguanine. However, the mechanism by which 8-aminoguanine affects renal function is unknown and is the focus of this investigation. Methods and Results Because 8-aminoguanine has structural similarities with inhibitors of the epithelial sodium channel (ENaC), Na+/H+ exchangers, and adenosine A1 receptors, we examined the effects of 8-aminoguanine on EN aC activity in mouse collecting duct cells, on intracellular pH of human proximal tubular epithelial cells, on responses to a selective A1-receptor agonist in vivo, and on renal excretory function in A1-receptor knockout rats. These experiments showed that 8-aminoguanine did not block EN aC, Na+/H+ exchangers, or A1 receptors. Because Rac1 enhances activity of mineralocorticoid receptors and some guanosine analogues inhibit Rac1, we examined the effects of 8-aminoguanine on Rac1 activity in mouse collecting duct cells. Rac1 activity was significantly inhibited by 8-aminoguanine. Because in vitro 8-aminoguanine is a purine nucleoside phosphorylase ( PNP ase) inhibitor, we examined the effects of a natriuretic dose of 8-aminoguanine on urinary excretion of PNP ase substrates and products. 8-Aminoguanine increased and decreased, respectively, urinary excretion of PNP ase substrates and products. Next we compared in rats the renal effects of intravenous doses of 9-deazaguanine ( PNP ase inhibitor) versus 8-aminoguanine. 8-Aminoguanine and 9-deazaguanine induced similar increases in urinary Na+ and glucose excretion, yet only 8-aminoguanine reduced K+ excretion. Nsc23766 (Rac1 inhibitor) mimicked the effects of 8-aminoguanine on K+ excretion. Conclusions 8-Aminoguanine increases Na+ and glucose excretion by blocking PNP ase and decreases K+ excretion by inhibiting Rac1.

Adult Idiopathic Renal Fanconi Syndrome: A Case Report

Renal Fanconi syndrome (RFS) is caused by generalized proximal tubular dysfunction and can be divided into hereditary and acquired form. Adult-onset RFS is usually associated with drug toxicity or systemic disorders, and modern molecular genetics may explain the etiology of previous idiopathic cases of RFS. Here, we report the case of a 52-year-old woman with RFS whose etiology could not be identified. She presented with features of phosphaturia, renal glucosuria, aminoaciduria, tubular proteinuria, and proximal renal tubular acidosis. Her family history was unremarkable, and previous medications were nonspecific. Her bone mineral density was compatible with osteoporosis, serum intact parathyroid hormone level was mildly elevated, and 25(OH) vitamin D level was insufficient. Her blood urea nitrogen and serum creatinine levels were 8.4 and 1.19 mg/dL, respectively (estimated glomerular filtration rate, 53 mL/min/1.73 m²). Percutaneous renal biopsy was performed but revealed no specific renal pathology, including mitochondrial morphology. No mutation was detected in EHHADH gene. We propose the possibility of involvement of other genes or molecules in this case of adult RFS.

Genetic analysis and literature review of Chinese patients with familial renal glucosuria: Identification of a novel SLC5A2 mutation.

BACKGROUND: Familial renal glucosuria (FRG) is an inherited renal tubular disorder characterized by persistent isolated glucosuria with normal blood glucose. SLC5A2 gene mutation was the causative of FRG. METHODS: Molecular genetic analysis of SLC5A2 gene by Sanger sequencing was conducted in two unrelated non-consanguineous Chinese families with isolated glucosuria. Extensive laboratory test and physical examination were performed. In silico algorithms were used to explore the potential effect of novel mutation on SGLT2 function. We also summarized the reported SLC5A2 mutations in the Chinese patients with FRG. RESULTS: A novel missense mutation (c.877A>T, p.Ser293Cys) in exon 3 was detected in proband 1 with weight loss accompanying by glucosuria and in her father with normal phenotype. In family 2, a previously reported compound heterozygous mutation (c.229G>C, p.Gly77Arg; c.1540C>T, p.Pro514Ser) was identified, and her healthy parents were heterozygous mutation carriers. The p.S293C mutation was predicted to be pathogenic. No hot spot mutation was found in reported Chinese patients with FRG. CONCLUSIONS: The novel pathogenic SLC5A2 mutation p.S293C was responsible for the onset of FRG. Our study further confirmed the co-dominant inheritance trait with variable penetrance and expanded the clinical and genetic spectrum of FRG.

Clinical and Genetic Features of Patients With Type 2 Diabetes and Renal Glycosuria.

Context: A sodium glucose cotransporter 2 (SGLT2) inhibitor, which increases urinary glucose excretion, was reported to decrease blood glucose levels and deaths among patients with type 2 diabetes mellitus (T2DM) and established cardiovascular disease. SLC5A2 and HNF1A mutations are associated with renal glycosuria, but their contributions to renal glycosuria in patients with T2DM are not well understood. Objective: To assess the clinical features of patients with T2DM and renal glycosuria and those with T2DM and low urinary glucose excretion (LUGE) and identify variants in the exons of SLC5A2 and HNF1A in patients with renal glycosuria and T2DM. Design: A total of 2044 Chinese patients with T2DM, including 64 patients with renal glycosuria and 58 patients with LUGE, were tested for their plasma and urine glucose concentrations after fasting. SLC5A2 and HNF1A exons were sequenced. Results: Compared with patients with LUGE, those with renal glycosuria were younger (P = 0.008), had lower body mass index (BMI) (P = 0.002) and Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) values (P < 0.0001), and were less likely to have hypertension (P = 0.006). HOMA-IR and BMI were negatively associated with renal glycosuria after adjusting for age, sex, hypertension, and insulin therapy. One novel mutation (V359G) of SLC5A2 in 32 patients with renal glycosuria and one known mutation (R131W) of HNF1A in 28 nonobese patients with renal glycosuria were identified. Conclusions: These findings suggest that there are subtypes of T2DM characterized by different urinary glucose excretion and cardiovascular risk factors. SLC5A2 and HNF1A mutations partially explain renal glycosuria in patients with T2DM.

Renal glucosuria is not associated with atherosclerotic cardiovascular disease outcome in a general Japanese community.

BACKGROUND AND AIMS: Renal glucosuria is defined as the excretion of detectable amounts of glucose in the urine without diabetes or hyperglycemia. Few data exist regarding the prevalence of renal glucosuria and its clinical impact on atherosclerotic cardiovascular diseases. METHODS: This study included 47,842 subjects (16,913 men, 35.4%) aged ≥40 years who underwent the Japanese specific health checkup in Kanazawa City during 2014. We defined renal glucosuria as fulfillment of all of the following three criteria: 1) detectable glucosuria; 2) the absence of diabetes; 3) normal blood glucose (<110 mg/dl fasting, and <140 mg/dl non-fasting). The presence of renal glucosuria and of factors associated with atherosclerotic cardiovascular diseases, including coronary artery disease and stroke, was assessed. RESULTS: The criteria for renal glucosuria were met by 665 (1.4%) subjects. Significantly higher proportions of subjects with renal glucosuria exhibited coronary artery disease, stroke, or either outcome than those without (14.9% vs. 12.1%, p = 0.0305; 9.9% vs. 6.9%, p = 0.00255; 22.3% vs. 17.0%, p = 4.0 × 10-4, respectively), but multivariate logistic regression analyses revealed that renal glucosuria was not associated with coronary artery disease (odds ratio [OR] = 0.940, 95% confidence interval [CI] = 0.748-1.171, not significant), stroke (OR = 1.122, 95% CI = 0.853-1.453, not significant), or atherosclerotic cardiovascular diseases (OR = 1.122, 95% CI = 0.853-1.453, not significant). CONCLUSIONS: These results indicate that the prevalence of renal glucosuria in the Japanese general population was 1.4%, and that renal glucosuria was not associated with atherosclerotic cardiovascular diseases per se.